plasmid (Addgene inc)
Addgene inc is a verified supplier 
92
Structured Review
Addgene inc
plasmid
Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ptriex+rhoa+flare+sc+biosensor+wt/pTriEx-RhoA+FLARE%2Esc+Biosensor+WT+(Plasmid+%2312150)/pmc12307676-28-7-10
Average 92 stars, based on 30 article reviews
Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ptriex+rhoa+flare+sc+biosensor+wt/pTriEx-RhoA+FLARE%2Esc+Biosensor+WT+(Plasmid+%2312150)/pmc12307676-28-7-10
Average 92 stars, based on 30 article reviews
plasmid - by Bioz Stars,
2026-09
92/100 stars
Images
Related Articles
shRNA:Article Title: STXBP5/tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors Article Snippet: L412V or Y502C point mutation was introduced by site-directed mutagenesis (Agilent Technologies, QuikChange II XL Site-Directed Mutagenesis Kit, Cat# 200521) using pcDNA TM 4/ myc -His-m-tomosyn-GFP plasmid as a template. .. The shRNA-resistant tomosyn (wild-type WT r -Tom-GFP, L412V r -Tom-GFP, and Y502C r -Tom-GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5’-AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA-3’ and Reverse 5’-TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT-3’. shTomosyn-WT r -Tom-RFP, shTomosyn-L412V r -Tom-RFP, and shTomosyn-Y502C r -Tom-RFP were generated by inserting WT r -Tom, L412V r -Tom or Y502C r -Tom into the shTomosyn vector. pcDNA3-EGFP-RhoA-WT (Addgene, plasmid # 12965) and pcDNA3-EGFP-RhoA-T19N (Addgene, plasmid # 12967) were a gift from Gary Bokoch ( ). pCI-SEP-GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow ( ). Article Title: Tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors Article Snippet: L412V or Y502C point mutation was introduced by site‐directed mutagenesis (QuikChange II XL Site‐Directed Mutagenesis Kit, Agilent Technologies) using pcDNATM4/ myc ‐His‐m‐tomosyn‐GFP plasmid as a template. .. The shRNA‐resistant tomosyn (wild‐type WT r ‐Tom‐GFP, L412V r ‐Tom‐GFP, and Y502C r ‐Tom‐GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5′‐AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA‐3′ and Reverse 5′‐TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT‐3′. shTomosyn‐WT r ‐Tom‐RFP, shTomosyn‐L412V r ‐Tom‐RFP, and shTomosyn‐Y502C r ‐Tom‐RFP were generated by inserting WT r ‐Tom, L412V r ‐Tom, or Y502C r ‐Tom into the shTomosyn vector. pcDNA3‐EGFP‐RhoA‐WT (Addgene, plasmid # 12965) and pcDNA3‐EGFP‐RhoA‐T19N (Addgene, plasmid # 12967) were gifts from Gary Bokoch (Subauste et al., ). pCI‐SEP‐GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow (Kopec, Li, Wei, Boehm, & Malinow, ). Construct:Article Title: STXBP5/tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors Article Snippet: L412V or Y502C point mutation was introduced by site-directed mutagenesis (Agilent Technologies, QuikChange II XL Site-Directed Mutagenesis Kit, Cat# 200521) using pcDNA TM 4/ myc -His-m-tomosyn-GFP plasmid as a template. .. The shRNA-resistant tomosyn (wild-type WT r -Tom-GFP, L412V r -Tom-GFP, and Y502C r -Tom-GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5’-AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA-3’ and Reverse 5’-TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT-3’. shTomosyn-WT r -Tom-RFP, shTomosyn-L412V r -Tom-RFP, and shTomosyn-Y502C r -Tom-RFP were generated by inserting WT r -Tom, L412V r -Tom or Y502C r -Tom into the shTomosyn vector. pcDNA3-EGFP-RhoA-WT (Addgene, plasmid # 12965) and pcDNA3-EGFP-RhoA-T19N (Addgene, plasmid # 12967) were a gift from Gary Bokoch ( ). pCI-SEP-GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow ( ). Article Title: Tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors Article Snippet: L412V or Y502C point mutation was introduced by site‐directed mutagenesis (QuikChange II XL Site‐Directed Mutagenesis Kit, Agilent Technologies) using pcDNATM4/ myc ‐His‐m‐tomosyn‐GFP plasmid as a template. .. The shRNA‐resistant tomosyn (wild‐type WT r ‐Tom‐GFP, L412V r ‐Tom‐GFP, and Y502C r ‐Tom‐GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5′‐AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA‐3′ and Reverse 5′‐TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT‐3′. shTomosyn‐WT r ‐Tom‐RFP, shTomosyn‐L412V r ‐Tom‐RFP, and shTomosyn‐Y502C r ‐Tom‐RFP were generated by inserting WT r ‐Tom, L412V r ‐Tom, or Y502C r ‐Tom into the shTomosyn vector. pcDNA3‐EGFP‐RhoA‐WT (Addgene, plasmid # 12965) and pcDNA3‐EGFP‐RhoA‐T19N (Addgene, plasmid # 12967) were gifts from Gary Bokoch (Subauste et al., ). pCI‐SEP‐GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow (Kopec, Li, Wei, Boehm, & Malinow, ). Polymerase Chain Reaction:Article Title: STXBP5/tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors Article Snippet: L412V or Y502C point mutation was introduced by site-directed mutagenesis (Agilent Technologies, QuikChange II XL Site-Directed Mutagenesis Kit, Cat# 200521) using pcDNA TM 4/ myc -His-m-tomosyn-GFP plasmid as a template. .. The shRNA-resistant tomosyn (wild-type WT r -Tom-GFP, L412V r -Tom-GFP, and Y502C r -Tom-GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5’-AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA-3’ and Reverse 5’-TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT-3’. shTomosyn-WT r -Tom-RFP, shTomosyn-L412V r -Tom-RFP, and shTomosyn-Y502C r -Tom-RFP were generated by inserting WT r -Tom, L412V r -Tom or Y502C r -Tom into the shTomosyn vector. pcDNA3-EGFP-RhoA-WT (Addgene, plasmid # 12965) and pcDNA3-EGFP-RhoA-T19N (Addgene, plasmid # 12967) were a gift from Gary Bokoch ( ). pCI-SEP-GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow ( ). Article Title: Tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors Article Snippet: L412V or Y502C point mutation was introduced by site‐directed mutagenesis (QuikChange II XL Site‐Directed Mutagenesis Kit, Agilent Technologies) using pcDNATM4/ myc ‐His‐m‐tomosyn‐GFP plasmid as a template. .. The shRNA‐resistant tomosyn (wild‐type WT r ‐Tom‐GFP, L412V r ‐Tom‐GFP, and Y502C r ‐Tom‐GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5′‐AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA‐3′ and Reverse 5′‐TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT‐3′. shTomosyn‐WT r ‐Tom‐RFP, shTomosyn‐L412V r ‐Tom‐RFP, and shTomosyn‐Y502C r ‐Tom‐RFP were generated by inserting WT r ‐Tom, L412V r ‐Tom, or Y502C r ‐Tom into the shTomosyn vector. pcDNA3‐EGFP‐RhoA‐WT (Addgene, plasmid # 12965) and pcDNA3‐EGFP‐RhoA‐T19N (Addgene, plasmid # 12967) were gifts from Gary Bokoch (Subauste et al., ). pCI‐SEP‐GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow (Kopec, Li, Wei, Boehm, & Malinow, ). Generated:Article Title: STXBP5/tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors Article Snippet: L412V or Y502C point mutation was introduced by site-directed mutagenesis (Agilent Technologies, QuikChange II XL Site-Directed Mutagenesis Kit, Cat# 200521) using pcDNA TM 4/ myc -His-m-tomosyn-GFP plasmid as a template. .. The shRNA-resistant tomosyn (wild-type WT r -Tom-GFP, L412V r -Tom-GFP, and Y502C r -Tom-GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5’-AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA-3’ and Reverse 5’-TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT-3’. shTomosyn-WT r -Tom-RFP, shTomosyn-L412V r -Tom-RFP, and shTomosyn-Y502C r -Tom-RFP were generated by inserting WT r -Tom, L412V r -Tom or Y502C r -Tom into the shTomosyn vector. pcDNA3-EGFP-RhoA-WT (Addgene, plasmid # 12965) and pcDNA3-EGFP-RhoA-T19N (Addgene, plasmid # 12967) were a gift from Gary Bokoch ( ). pCI-SEP-GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow ( ). Article Title: Tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors Article Snippet: L412V or Y502C point mutation was introduced by site‐directed mutagenesis (QuikChange II XL Site‐Directed Mutagenesis Kit, Agilent Technologies) using pcDNATM4/ myc ‐His‐m‐tomosyn‐GFP plasmid as a template. .. The shRNA‐resistant tomosyn (wild‐type WT r ‐Tom‐GFP, L412V r ‐Tom‐GFP, and Y502C r ‐Tom‐GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5′‐AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA‐3′ and Reverse 5′‐TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT‐3′. shTomosyn‐WT r ‐Tom‐RFP, shTomosyn‐L412V r ‐Tom‐RFP, and shTomosyn‐Y502C r ‐Tom‐RFP were generated by inserting WT r ‐Tom, L412V r ‐Tom, or Y502C r ‐Tom into the shTomosyn vector. pcDNA3‐EGFP‐RhoA‐WT (Addgene, plasmid # 12965) and pcDNA3‐EGFP‐RhoA‐T19N (Addgene, plasmid # 12967) were gifts from Gary Bokoch (Subauste et al., ). pCI‐SEP‐GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow (Kopec, Li, Wei, Boehm, & Malinow, ). Plasmid Preparation:Article Title: STXBP5/tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors Article Snippet: L412V or Y502C point mutation was introduced by site-directed mutagenesis (Agilent Technologies, QuikChange II XL Site-Directed Mutagenesis Kit, Cat# 200521) using pcDNA TM 4/ myc -His-m-tomosyn-GFP plasmid as a template. .. The shRNA-resistant tomosyn (wild-type WT r -Tom-GFP, L412V r -Tom-GFP, and Y502C r -Tom-GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5’-AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA-3’ and Reverse 5’-TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT-3’. shTomosyn-WT r -Tom-RFP, shTomosyn-L412V r -Tom-RFP, and shTomosyn-Y502C r -Tom-RFP were generated by inserting WT r -Tom, L412V r -Tom or Y502C r -Tom into the shTomosyn vector. pcDNA3-EGFP-RhoA-WT (Addgene, plasmid # 12965) and pcDNA3-EGFP-RhoA-T19N (Addgene, plasmid # 12967) were a gift from Gary Bokoch ( ). pCI-SEP-GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow ( ). Article Title: Optogenetic control of small GTPases reveals RhoA mediates intracellular calcium signaling Article Snippet: CMV-R-GECO1 ( ) and pDDRFP-A1B1-DEVD ( ) were gifted by Robert Campbell (Addgene plasmid #32444 and #36294). pcDNA3-HA-human OCRL ( ) was supplied by Pietro De Camilli (Addgene plasmid #22207). .. GFP-C1-PLCdelta-PH ( ) was obtained from Tobias Meyer (Addgene plasmid #21179). Article Title: Tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors Article Snippet: L412V or Y502C point mutation was introduced by site‐directed mutagenesis (QuikChange II XL Site‐Directed Mutagenesis Kit, Agilent Technologies) using pcDNATM4/ myc ‐His‐m‐tomosyn‐GFP plasmid as a template. .. The shRNA‐resistant tomosyn (wild‐type WT r ‐Tom‐GFP, L412V r ‐Tom‐GFP, and Y502C r ‐Tom‐GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5′‐AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA‐3′ and Reverse 5′‐TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT‐3′. shTomosyn‐WT r ‐Tom‐RFP, shTomosyn‐L412V r ‐Tom‐RFP, and shTomosyn‐Y502C r ‐Tom‐RFP were generated by inserting WT r ‐Tom, L412V r ‐Tom, or Y502C r ‐Tom into the shTomosyn vector. pcDNA3‐EGFP‐RhoA‐WT (Addgene, plasmid # 12965) and pcDNA3‐EGFP‐RhoA‐T19N (Addgene, plasmid # 12967) were gifts from Gary Bokoch (Subauste et al., ). pCI‐SEP‐GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow (Kopec, Li, Wei, Boehm, & Malinow, ). Article Title: Optogenetic control of small GTPases reveals RhoA mediates intracellular calcium signaling Article Snippet: .. Data from Tobias Meyer (Addgene plasmid #21179). Article Title: Optogenetic control of small GTPases reveals RhoA-mediated intracellular calcium signaling Article Snippet: CMV-R-GECO1 ( ) and pDDRFP-A1B1-DEVD ( ) were gifted by Robert Campbell (Addgene plasmid #32444 and #36294). pcDNA3-HA-human OCRL ( ) was supplied by Pietro De Camilli (Addgene plasmid #22207). .. GFP-C1-PLCdelta-PH ( ) was obtained from Tobias Meyer (Addgene plasmid #21179). Article Title: Tumor-resident intracellular microbiota promotes metastatic colonization in breast cancer. Article Snippet: .. The PCDH lentivector backbonewas used for the cloning of the biosensor and the complete biosensor can be amplified from Article Title: The nucleus measures shape changes for cellular proprioception to control dynamic cell behavior. Article Snippet: .. We thank the following labs that kindly provided plasmids: pCS2+ lefty/casanova (courtesy C.-P. Heisenberg); pCS2+ lyn-TdTomato (courtesy B. Alsina); other:Article Title: RhoA balances microglial reactivity and survival during neuroinflammation. Article Snippet: Raichu-RhoA (provided by M. Matsuda [27]), Cloning:Article Title: Tumor-resident intracellular microbiota promotes metastatic colonization in breast cancer. Article Snippet: .. The PCDH lentivector backbonewas used for the cloning of the biosensor and the complete biosensor can be amplified from Amplification:Article Title: Tumor-resident intracellular microbiota promotes metastatic colonization in breast cancer. Article Snippet: .. The PCDH lentivector backbonewas used for the cloning of the biosensor and the complete biosensor can be amplified from |